Atp2b3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp2b3^em1(IMPC)J
• Name: ATPase, Ca++ transporting, plasma membrane 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5805216
• Synonyms: Atp2b3^em1J
• Gene: Atp2b3 Location: ChrX:72546692-72614611 bp, + strand Genetic Position: ChrX, 37.33 cM
• Alliance: Atp2b3^em1(IMPC)J page
• IMPC: Atp2b3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Atp2b3-8009J-F4670 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATGACTCTATGGAACAAG, GTCCAGTCAGGGCCTTTGCA, TTACTAATACATCCTAGCAG and TGGGCATCTTAGGTGTAGAG, which resulted in a 464 bp deletion beginning at Chromosome X positive strand position 73,536,041 bp, AAGGCCCTGACTGGACTCAG, and ending after ACTTTACTAATACATCCTAG at 73,536,504 bp (GRCm38/mm10). This mutation deletes exon 9 and 249 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 3 bp deletion (GTT) 50 bp 5-prime of the 464 bp deletion which will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 374 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Atp2b3 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)