Cep135^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep135^em1(IMPC)J
• Name: centrosomal protein 135; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5805217
• Synonyms: Cep135^em1J
• Gene: Cep135 Location: Chr5:76736545-76794313 bp, + strand Genetic Position: Chr5, 41.31 cM
• Alliance: Cep135^em1(IMPC)J page
• IMPC: Cep135 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cep135-8015J-M4780 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTTCTTTCAGGGTATCAAA, GGCCTGTTTTGAGAAACTTG, CTAACCACAGTTCTATTCAT and CCTAAAAACCAAAGAGGGCA, which resulted in a 383 bp deletion beginning at Chromosome 5 positive strand position 76,593,055 bp, TTTGAGAAACTTGAGGACCCT, and ending after TAATGAAGGCTCCTTGCCCTC at 76,593,437 bp (GRCm38/mm10). This mutation deletes exon 2 and 192 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 4 bp deletion (GAAT) 88 bp 3-prime of the 383 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 37 and early truncation 11 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cep135 Mutation: 72 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)