About   Help   FAQ
Cep135em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cep135em1(IMPC)J
Name: centrosomal protein 135; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5805217
Synonyms: Cep135em1J
Gene: Cep135  Location: Chr5:76736545-76794313 bp, + strand  Genetic Position: Chr5, 41.31 cM
Alliance: Cep135em1(IMPC)J page
IMPC: Cep135 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cep135-8015J-M4780 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTTCTTTCAGGGTATCAAA, GGCCTGTTTTGAGAAACTTG, CTAACCACAGTTCTATTCAT and CCTAAAAACCAAAGAGGGCA, which resulted in a 383 bp deletion beginning at Chromosome 5 positive strand position 76,593,055 bp, TTTGAGAAACTTGAGGACCCT, and ending after TAATGAAGGCTCCTTGCCCTC at 76,593,437 bp (GRCm38/mm10). This mutation deletes exon 2 and 192 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 4 bp deletion (GAAT) 88 bp 3-prime of the 383 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 37 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 8 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Cep135 Mutation:  72 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory