About   Help   FAQ
Tmem87bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem87bem1(IMPC)J
Name: transmembrane protein 87B; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5805532
Synonyms: Tmem87bem1J
Gene: Tmem87b  Location: Chr2:128660038-128696181 bp, + strand  Genetic Position: Chr2, 62.63 cM, cytoband F3
Alliance: Tmem87bem1(IMPC)J page
IMPC: Tmem87b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from project Tmem87b-7963J-F1351 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCAGTGATTTAGAGAAATT, CATTAAATTTTAACAGCTAC, CGTGTGTACAAAGCTGTGAA and CCAGCTGAGTAGGCTACAAG, which resulted in a 258 bp deletion beginning at Chromosome 2 positive strand position 128,824,346 bp, CAGCATTCTTGAAGCTTCAA, and ending after CTGAGTAGGCTACAAGTGGA at 128,824,603 bp (GRCm38/mm10). This mutation deletes exon 3 and 163 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 7bp (TGCGTGT) insertion at the site of the 258 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 75 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tmem87b Mutation:  36 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory