Tmem87b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmem87b^em1(IMPC)J
• Name: transmembrane protein 87B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5805532
• Synonyms: Tmem87b^em1J
• Gene: Tmem87b Location: Chr2:128660038-128696181 bp, + strand Genetic Position: Chr2, 62.63 cM, cytoband F3
• Alliance: Tmem87b^em1(IMPC)J page
• IMPC: Tmem87b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Tmem87b-7963J-F1351 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCAGTGATTTAGAGAAATT, CATTAAATTTTAACAGCTAC, CGTGTGTACAAAGCTGTGAA and CCAGCTGAGTAGGCTACAAG, which resulted in a 258 bp deletion beginning at Chromosome 2 positive strand position 128,824,346 bp, CAGCATTCTTGAAGCTTCAA, and ending after CTGAGTAGGCTACAAGTGGA at 128,824,603 bp (GRCm38/mm10). This mutation deletes exon 3 and 163 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 7bp (TGCGTGT) insertion at the site of the 258 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 75 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tmem87b Mutation: 36 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)