Kbtbd2^em1Btlr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kbtbd2^em1Btlr
• Name: kelch repeat and BTB (POZ) domain containing 2; endonuclease-mediated mutation 1, Bruce Beutler
• MGI ID: MGI:5806485
• Synonyms: Kbtbd2^-
• Gene: Kbtbd2 Location: Chr6:56754510-56774798 bp, - strand Genetic Position: Chr6, 27.73 cM
• Alliance: Kbtbd2^em1Btlr page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: A knockout allele was created using an sgRNA (targeting CCGCTGATTTGCATAAGGTT) with CRISPR/Cas9 technology. (J:236520)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Kbtbd2 Mutation: 50 strains or lines available

References

• Original: J:236520 Zhang Z, et al., Insulin resistance and diabetes caused by genetic or diet-induced KBTBD2 deficiency in mice. Proc Natl Acad Sci U S A. 2016 Oct 18;113(42):E6418-E6426
• All: 3 reference(s)