Pik3r1^em1Btlr
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pik3r1^em1Btlr
• Name: phosphoinositide-3-kinase regulatory subunit 1; endonuclease-mediated mutation 1, Bruce Beutler
• MGI ID: MGI:5806486
• Synonyms: Pik3r1^-
• Gene: Pik3r1 Location: Chr13:101817269-101904725 bp, - strand Genetic Position: Chr13, 53.92 cM
• Alliance: Pik3r1^em1Btlr page

Mutation origin

• Strain of Origin: Not Specified
• Project Collection: Beutler Mutagenetix

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: A knockout allele was created using an sgRNA (targeting AGTCGTACAGTGCTCTGTAC) with CRISPR/Cas9 technology. (J:236520)

Phenotypes

Key:

hm	homozygous	ht	heterozygous	tg	involves transgenes	√	phenotype observed
cn	conditional genotype	cx	complex: > 1 genome feature	ot	other: hemizygous, indeterminate,...	N	normal phenotype

Genotype/
Background:

	Allelic Composition	Genetic Background	Cell Line(s)
Loading...
cx1	Kbtbd2^em1Btlr/Kbtbd2^em1Btlr Pik3r1^em1Btlr/Pik3r1^em1Btlr	Not Specified

Phenotypes:

Affected Systems	cx1
show or hide all annotated terms Sex:
adipose tissue	√
increased body fat mass	√
growth/size/body	√
increased body fat mass	√
increased body weight	√
homeostasis/metabolism	√
decreased circulating glucose level	√
decreased circulating insulin level	√
increased insulin sensitivity	√

View phenotypes and curated references for all genotypes (concatenated display).

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pik3r1 Mutation: 56 strains or lines available

References

• Original: J:236520 Zhang Z, et al., Insulin resistance and diabetes caused by genetic or diet-induced KBTBD2 deficiency in mice. Proc Natl Acad Sci U S A. 2016 Oct 18;113(42):E6418-E6426
• All: 1 reference(s)