Arhgap44^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap44^em1(IMPC)J
• Name: Rho GTPase activating protein 44; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5806663
• Synonyms: Arhgap44^em1J
• Gene: Arhgap44 Location: Chr11:64892865-65053779 bp, - strand Genetic Position: Chr11, 40.42 cM
• Alliance: Arhgap44^em1(IMPC)J page
• IMPC: Arhgap44 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Arhgap44-8008J-F4654 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTAGACCCTGACTGCAGAT, ACTTAGTACAAGCACACACA, GCGGGTGGAAGATTTTCAGT and ATAGTTTACTAATATAACTG, which resulted in a 88 bp deletion beginning at Chromosome 11 negative strand position 65,067,147 bp CCTCTGACGACTCTGGCGCA, and ending after TAAGGTGACCCCATGTGTG at 65,067,060 bp (GRCm38/mm10). This mutation deletes 68 bp of exon 4 and 20 bp of 3-prime flanking intronic sequence including the splice donor. The deletion of part of exon 4 but retention of the splice acceptor is predicted to lead to amino acid change after residue 69 and early truncation 3 amino acids later due to read through into intron 5. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Arhgap44 Mutation: 37 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)