Zfp711^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp711^em1(IMPC)J
• Name: zinc finger protein 711; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5807188
• Synonyms: Zfp711^em1J
• Gene: Zfp711 Location: ChrX:111510259-111544767 bp, + strand Genetic Position: ChrX, 48.76 cM
• Alliance: Zfp711^em1(IMPC)J page
• IMPC: Zfp711 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp711-8046J-F4983 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGATGTTGTCACAGATGA, CTGATGTTGTCACAGATGAT, AGATATCATTAAGTAGTCTT and TTCTACTGTTACCATAAAAA, which resulted in a 439 bp internal deletion beginning at Chromosome X positive strand position 112,614,979 bp, ACAGATGATGGGATAACTCT, and ending after TGTCAAGAGCACTTCTGAAG at 112,615,417 bp (GRCm38/mm10). This mutation deletes 439 bp from exon 3, and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfp711 Mutation: 5 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)