Dnajb2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dnajb2^em1(IMPC)J
• Name: DnaJ heat shock protein family (Hsp40) member B2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5807189
• Synonyms: Dnajb2^em1J
• Gene: Dnajb2 Location: Chr1:75213050-75222336 bp, + strand Genetic Position: Chr1, 38.64 cM, cytoband C3
• Alliance: Dnajb2^em1(IMPC)J page
• IMPC: Dnajb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dnajb2-8031J-M7944 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATATCCCTGGCACACCACA, GGTGTTGGACTAAGCAAAAA, GAAGGAGTACCAAGAATGAA and CATGTTATGTCTGTCTAGCA, which resulted in a 319 bp deletion beginning at Chromosome 1 positive strand position 75,237,297 bp GGCACACCACAGGGAGAGAA, and ending after GTCCCCCTGCTTCCATTCAT at 75,237,615 bp (GRCm38/mm10). This mutation deletes exon 3 and 209 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dnajb2 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)