Actg2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Actg2^em1(IMPC)J
• Name: actin, gamma 2, smooth muscle, enteric; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5807486
• Synonyms: Actg2^em1J
• Gene: Actg2 Location: Chr6:83489891-83513233 bp, - strand Genetic Position: Chr6, 35.94 cM
• Alliance: Actg2^em1(IMPC)J page
• IMPC: Actg2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Actg2-8089J-M2448 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGATTGTGAAGAAAAACC, CAGGATTGTGAAGAAAAACC, ACCCCATATCCACTTCCCAT and ACAGATCTGCTGTGGTTGGG, which resulted in a 484 bp deletion beginning at Chromosome 6 negative strand position 83,523,034 bp CATGGGAAGTGGATATGGGG, and ending after GAGTTCCCAACAGAGAGTCC at 83,522,551 bp (GRCm38/mm10). This mutation deletes exon 5 and 399 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp deletion 40 bp before the start of the 484 bp deletion that will not alter the result of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 40 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Actg2 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)