About   Help   FAQ
Actg2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Actg2em1(IMPC)J
Name: actin, gamma 2, smooth muscle, enteric; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5807486
Synonyms: Actg2em1J
Gene: Actg2  Location: Chr6:83489891-83513233 bp, - strand  Genetic Position: Chr6, 35.94 cM
Alliance: Actg2em1(IMPC)J page
IMPC: Actg2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Actg2-8089J-M2448 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGATTGTGAAGAAAAACC, CAGGATTGTGAAGAAAAACC, ACCCCATATCCACTTCCCAT and ACAGATCTGCTGTGGTTGGG, which resulted in a 484 bp deletion beginning at Chromosome 6 negative strand position 83,523,034 bp CATGGGAAGTGGATATGGGG, and ending after GAGTTCCCAACAGAGAGTCC at 83,522,551 bp (GRCm38/mm10). This mutation deletes exon 5 and 399 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp deletion 40 bp before the start of the 484 bp deletion that will not alter the result of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 40 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Actg2 Mutation:  17 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory