About   Help   FAQ
Ankrd35em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ankrd35em1(IMPC)J
Name: ankyrin repeat domain 35; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5810098
Synonyms: Ankrd35em1J
Gene: Ankrd35  Location: Chr3:96577447-96598348 bp, + strand  Genetic Position: Chr3, 41.94 cM
Alliance: Ankrd35em1(IMPC)J page
IMPC: Ankrd35 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ankrd35-8102J-M2490 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAGACCTAAAGGTGCTTAG, GGATAATTCTTGATGACACA, GAAGTTCGAACCACATACCA and AGTCAGTGTGGCTTGTGCGG, which resulted in a 383 bp deletion beginning at Chromosome 3 positive strand position 96,677,914 bp TGACACATGGAGTGGTTAGT, and ending after TTTGACCCCACCCTGGTATG at 96,678,296 bp (GRCm38/mm10). This mutation deletes exon 2 and 252 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 14 and early truncation 20 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ankrd35 Mutation:  217 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory