Ankrd35^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankrd35^em1(IMPC)J
• Name: ankyrin repeat domain 35; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5810098
• Synonyms: Ankrd35^em1J
• Gene: Ankrd35 Location: Chr3:96577447-96598348 bp, + strand Genetic Position: Chr3, 41.94 cM
• Alliance: Ankrd35^em1(IMPC)J page
• IMPC: Ankrd35 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ankrd35-8102J-M2490 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAGACCTAAAGGTGCTTAG, GGATAATTCTTGATGACACA, GAAGTTCGAACCACATACCA and AGTCAGTGTGGCTTGTGCGG, which resulted in a 383 bp deletion beginning at Chromosome 3 positive strand position 96,677,914 bp TGACACATGGAGTGGTTAGT, and ending after TTTGACCCCACCCTGGTATG at 96,678,296 bp (GRCm38/mm10). This mutation deletes exon 2 and 252 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 14 and early truncation 20 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ankrd35 Mutation: 217 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)