Acy3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Acy3^em1(IMPC)J
• Name: aminoacylase 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5810346
• Synonyms: Acy3^em1J
• Gene: Acy3 Location: Chr19:4036570-4040007 bp, + strand Genetic Position: Chr19, 3.7 cM
• Alliance: Acy3^em1(IMPC)J page
• IMPC: Acy3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Acy3-8100J-M3948 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGAAGTGAGACATACATG, GCTAACTTCTCACCTTTGGT, GTTTCCCCTCAAGAAGGCCT and GCCCTCCTTCCTGCCCCCTA, which resulted in a 437 bp deletion beginning at Chromosome 19 positive strand position 3,987,498 bp, ATGGGGAACAGGACCAACAT, and ending after TACCTACAGGTGGTCCCTAG at 3,987,934 bp (GRCm38/mm10). This mutation deletes exon 2 and 244 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 63 bp deletion 154 bp downstream of the 437 bp deletion. Overall this mutation is predicted to cause a change of amino acid sequence after residue 79 and early truncation 110 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Acy3 Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)