Reps2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Reps2^em1(IMPC)J
• Name: RALBP1 associated Eps domain containing protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5812581
• Synonyms: Reps2^em1J
• Gene: Reps2 Location: ChrX:161194950-161426645 bp, - strand Genetic Position: ChrX, 74.67 cM
• Alliance: Reps2^em1(IMPC)J page
• IMPC: Reps2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Reps2-8146J-M5750 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTTTAGCAAGGTTATAGTG, TAGGATTAGATCCTTTCAGC, GTTTTTCCTGTTATGAAATG and AAAATAAAGATGACAAACGC, which resulted in a 616 bp deletion beginning at Chromosome X negative strand position 162,565,597 bp, TTCAAAAGAGGAGGAATAAT, and ending after TCAGCTGGCAGTTAAGGTAG at 162,564,982 bp (GRCm38/mm10). This mutation deletes exon 2 and 492 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2bp insertion (AT) before the deletion and a 20 bp deletion (TATTCTTTAGCAAGGTTATA) after the 616 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 78 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Reps2 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)