About   Help   FAQ
Slc26a10em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc26a10em1(IMPC)J
Name: solute carrier family 26, member 10; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812587
Synonyms: Slc26a10em1J
Gene: Slc26a10  Location: Chr10:127007262-127016514 bp, - strand  Genetic Position: Chr10, 74.5 cM
Alliance: Slc26a10em1(IMPC)J page
IMPC: Slc26a10 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Slc26a10-8158J-F2393 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGTGGCAGATATATCGTG, ATTGTGTTGGTCCTTTTCGG, GGTCTTCTAAGAGAGCGGAT and GCAGCAGCCAGGAACCGATG, which resulted in a 444 bp deletion beginning at Chromosome 10 positive strand position 127,178,593 bp, CGATATATCTGCCACTCCGG, and ending after CTGGTGCAGCAGCCAGGAAC at 127,179,036 bp (GRCm38/mm10). This mutation deletes exon 3 and 286 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 159 and early truncation 144 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc26a10 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory