About   Help   FAQ
Myo5cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Myo5cem1(IMPC)J
Name: myosin VC; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812660
Synonyms: Myo5cem1J
Gene: Myo5c  Location: Chr9:75139302-75212733 bp, + strand  Genetic Position: Chr9, 42.3 cM
Alliance: Myo5cem1(IMPC)J page
IMPC: Myo5c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Myo5c-8142J-M5690 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGTTTAGCAGAAATACCGA, GTGAGAAGTGCGTCTATGGG, GTGTAAGGAGAACTGCTCGT and GCTCGGGGCACGCAGACGGT, which resulted in a 490 bp deletion beginning at Chromosome 9 positive strand position 75,244,764 bp, CACTAGCAAGCAAACCATCCA, and ending after TCTGTGTAAGGAGAACTGCT at 75,245,253 bp (GRCm38/mm10). This mutation deletes exon 3 and 324 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (A) inserted 15 bp before the 490bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Myo5c Mutation:  94 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory