Myo5c^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myo5c^em1(IMPC)J
• Name: myosin VC; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5812660
• Synonyms: Myo5c^em1J
• Gene: Myo5c Location: Chr9:75139302-75212733 bp, + strand Genetic Position: Chr9, 42.3 cM
• Alliance: Myo5c^em1(IMPC)J page
• IMPC: Myo5c gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Myo5c-8142J-M5690 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGTTTAGCAGAAATACCGA, GTGAGAAGTGCGTCTATGGG, GTGTAAGGAGAACTGCTCGT and GCTCGGGGCACGCAGACGGT, which resulted in a 490 bp deletion beginning at Chromosome 9 positive strand position 75,244,764 bp, CACTAGCAAGCAAACCATCCA, and ending after TCTGTGTAAGGAGAACTGCT at 75,245,253 bp (GRCm38/mm10). This mutation deletes exon 3 and 324 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (A) inserted 15 bp before the 490bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 47 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Myo5c Mutation: 94 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)