About   Help   FAQ
Rgs19em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rgs19em1(IMPC)J
Name: regulator of G-protein signaling 19; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812668
Synonyms: Rgs19em1J
Gene: Rgs19  Location: Chr2:181330212-181335770 bp, - strand  Genetic Position: Chr2, 103.72 cM
Alliance: Rgs19em1(IMPC)J page
IMPC: Rgs19 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rgs19-8147J-M5764 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACAGCATCATCCTGCCCAG, AATACCCTGACGTCTTCCCA, GGTTATATCTTGAGCCCCAG and GGGCCCAGTGAATTCTAGAG, which resulted in a 500 bp deletion beginning at Chromosome 2 negative strand position 181,691,465 bp, TCCTGGACCCCTGGGGCTCA, and ending after CCTGCCACAGCATCATCCTG at 181,690,966 bp (GRCm38/mm10). This mutation deletes exon 3 and 378 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single base (C) insertion at the site of the 500 bp deletion that will have no effect on the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 10 and early truncation 22 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rgs19 Mutation:  14 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory