Rgs19^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rgs19^em1(IMPC)J
• Name: regulator of G-protein signaling 19; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5812668
• Synonyms: Rgs19^em1J
• Gene: Rgs19 Location: Chr2:181330212-181335770 bp, - strand Genetic Position: Chr2, 103.72 cM
• Alliance: Rgs19^em1(IMPC)J page
• IMPC: Rgs19 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Rgs19-8147J-M5764 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACAGCATCATCCTGCCCAG, AATACCCTGACGTCTTCCCA, GGTTATATCTTGAGCCCCAG and GGGCCCAGTGAATTCTAGAG, which resulted in a 500 bp deletion beginning at Chromosome 2 negative strand position 181,691,465 bp, TCCTGGACCCCTGGGGCTCA, and ending after CCTGCCACAGCATCATCCTG at 181,690,966 bp (GRCm38/mm10). This mutation deletes exon 3 and 378 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single base (C) insertion at the site of the 500 bp deletion that will have no effect on the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 10 and early truncation 22 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rgs19 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)