About   Help   FAQ
Greb1lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Greb1lem1(IMPC)J
Name: growth regulation by estrogen in breast cancer-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812878
Synonyms: Greb1lem1J
Gene: Greb1l  Location: Chr18:10325177-10562940 bp, + strand  Genetic Position: Chr18, 5.0 cM
Alliance: Greb1lem1(IMPC)J page
IMPC: Greb1l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Greb1l-8129J-M9444 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATTCTGCTGAGTTAAGAGG, ACTGGGCACTAACCACACAG, ACTGGGAATAAGTTACCAAT and GCCTTTACACCATGACTAAA, which resulted in a 512 bp deletion beginning at Chromosome 18 positive strand position 10,521,878 bp, AGTCTGACGTTTCCTCCTCT, and ending after TTGGTGTCTTCCCATTGGTA at 10,522,389 bp (GRCm38/mm10). This mutation deletes exon 16 and 331 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 42 bp insertion at the deletion site as well as a 2 bp (AC) deletion 90 bp before the insertion/deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 727 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Greb1l Mutation:  153 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory