Greb1l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Greb1l^em1(IMPC)J
• Name: growth regulation by estrogen in breast cancer-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5812878
• Synonyms: Greb1l^em1J
• Gene: Greb1l Location: Chr18:10325177-10562940 bp, + strand Genetic Position: Chr18, 5.0 cM
• Alliance: Greb1l^em1(IMPC)J page
• IMPC: Greb1l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Greb1l-8129J-M9444 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATTCTGCTGAGTTAAGAGG, ACTGGGCACTAACCACACAG, ACTGGGAATAAGTTACCAAT and GCCTTTACACCATGACTAAA, which resulted in a 512 bp deletion beginning at Chromosome 18 positive strand position 10,521,878 bp, AGTCTGACGTTTCCTCCTCT, and ending after TTGGTGTCTTCCCATTGGTA at 10,522,389 bp (GRCm38/mm10). This mutation deletes exon 16 and 331 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 42 bp insertion at the deletion site as well as a 2 bp (AC) deletion 90 bp before the insertion/deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 727 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Greb1l Mutation: 153 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)