About   Help   FAQ
Slmapem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slmapem1(IMPC)J
Name: sarcolemma associated protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812880
Synonyms: Slmapem1J
Gene: Slmap  Location: Chr14:26134323-26256086 bp, - strand  Genetic Position: Chr14, 16.09 cM, cytoband B
Alliance: Slmapem1(IMPC)J page
IMPC: Slmap gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Slmap-8150J-M2409 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTAAGATGAACTTACAGCG, CTATAGTGTCAGGAAGCGCT, TGAGTGGTTTCAGTTGATAG and CGTCTCAAAACTTTTAAAGA, which resulted in a 544 bp deletion beginning at Chromosome 14 negative strand position 26,483,082 bp, GTTTCAGTTGATAGGGGAAA, and ending after TAAGATGAACTTACAGCGTG at 26,482,539 bp (GRCm38/mm10). This mutation deletes exon 3 and 396 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slmap Mutation:  70 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory