Ankrd45^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ankrd45^em1(IMPC)J
• Name: ankyrin repeat domain 45; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5812890
• Synonyms: Ankrd45^em1J
• Gene: Ankrd45 Location: Chr1:160970261-160998068 bp, + strand Genetic Position: Chr1, 69.75 cM, cytoband H1
• Alliance: Ankrd45^em1(IMPC)J page
• IMPC: Ankrd45 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ankrd45-8103J-F3985 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTTGGGAAGATGTGTGTA, ATGCAGGGACTTGGGTTTTT, GAGTTATCCACTCATAAAGA and TTCTGCCCGGAATTATAGGT, which resulted in a 697 bp deletion beginning at Chromosome 1 positive strand position 161,150,840 bp, CCAAGTCCCTGCATCCCACA and ending after GTTGGTTATAATGTTAGAAA at 161,151,536 bp (GRCm38/mm10). This mutation deletes exon 2 and 344 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp del (A) 23 bp before the 697 bp deletion that will not effect the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 25 and early truncation 24 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ankrd45 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)