About   Help   FAQ
Sec14l1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Sec14l1em1(IMPC)J
Name: SEC14-like lipid binding 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5812905
Synonyms: Sec14l1em1J
Gene: Sec14l1  Location: Chr11:117005994-117050094 bp, + strand  Genetic Position: Chr11, 81.99 cM, cytoband E2
Alliance: Sec14l1em1(IMPC)J page
IMPC: Sec14l1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Sec14l1-8157J-M2381 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGATGTTGTGTGAACTG, ATGGTTCTCACTGGGTGACA, GCCGTGGGTTCCCCTCAGCG and TCACTGACCGCCACCAACCA, which resulted in a 608 bp deletion beginning at Chromosome 11 positive strand position 117,143,718 bp, TTGTGTGAACTGGGGAGTCT, and ending after ACCCCTTTAGTCTTGGCTGC at 117,144,325 bp (GRCm38/mm10). This mutation deletes exon 6 and 373 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp deletion (CACCCA) and a 1 bp (G) insertion 121 bp before the 608 bp exon deletion that will not alter the results of that deletion. This mutation is predicted to cause a change of amino acid sequence after residue 158 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sec14l1 Mutation:  30 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory