Sec14l1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Sec14l1^em1(IMPC)J
• Name: SEC14-like lipid binding 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5812905
• Synonyms: Sec14l1^em1J
• Gene: Sec14l1 Location: Chr11:117005994-117050094 bp, + strand Genetic Position: Chr11, 81.99 cM, cytoband E2
• Alliance: Sec14l1^em1(IMPC)J page
• IMPC: Sec14l1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Sec14l1-8157J-M2381 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGATGTTGTGTGAACTG, ATGGTTCTCACTGGGTGACA, GCCGTGGGTTCCCCTCAGCG and TCACTGACCGCCACCAACCA, which resulted in a 608 bp deletion beginning at Chromosome 11 positive strand position 117,143,718 bp, TTGTGTGAACTGGGGAGTCT, and ending after ACCCCTTTAGTCTTGGCTGC at 117,144,325 bp (GRCm38/mm10). This mutation deletes exon 6 and 373 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp deletion (CACCCA) and a 1 bp (G) insertion 121 bp before the 608 bp exon deletion that will not alter the results of that deletion. This mutation is predicted to cause a change of amino acid sequence after residue 158 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Sec14l1 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)