Cdc42bpb^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdc42bpb^em1(IMPC)J
• Name: CDC42 binding protein kinase beta; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5812907
• Synonyms: Cdc42bpb^em1J
• Gene: Cdc42bpb Location: Chr12:111259410-111344152 bp, - strand Genetic Position: Chr12, 60.94 cM
• Alliance: Cdc42bpb^em1(IMPC)J page
• IMPC: Cdc42bpb gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cdc42bpb-8192J-M1439 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACATATTACGCATGCGGGA, TACCGGCTCCTTACATCTGG, TACTTTCCTGGTTAGATCCG and GCATATTGCTGGGCTTTGGA, which resulted in a 589 bp deletion beginning at Chromosome 12 negative strand position 111,345,857 bp CTTCCAAAGCCCAGCAATAT, and ending after TTTCCCCCCCTCCCGCATGC at 111,345,269 bp (GRCm38/mm10). This mutation deletes exon 2 and 497 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cdc42bpb Mutation: 60 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)