Tecpr2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tecpr2^em1(IMPC)J
• Name: tectonin beta-propeller repeat containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5816118
• Synonyms: Tecpr2^em1J
• Gene: Tecpr2 Location: Chr12:110855698-110938828 bp, + strand Genetic Position: Chr12, 60.86 cM
• Alliance: Tecpr2^em1(IMPC)J page
• IMPC: Tecpr2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tecpr2-8162J-M2459 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGGTCAACAACGGCTCAG, GGCAGGTCAACAACGGCTCA, ATCTGGCTAATAGGAAACCT and GGCTACCAGGAACTCCAGGC, which resulted in a 287 bp deletion beginning at Chromosome 12 positive strand position 110,918,838 bp, GAGCCGTTGTTGACCTGCCT and ending after ACCACAGCCACACCAGCCTG at 110,919,124 bp (GRCm38/mm10). This mutation deletes exon 5 and 129 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 160 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tecpr2 Mutation: 68 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)