Zfp92^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp92^em1(IMPC)J
• Name: zinc finger protein 92; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5816145
• Synonyms: Zfp92^em1J
• Gene: Zfp92 Location: ChrX:72454702-72471991 bp, + strand Genetic Position: ChrX, 37.31 cM
• Alliance: Zfp92^em1(IMPC)J page
• IMPC: Zfp92 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp92-8178J-M8966 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGCTCTAAGATTCATGCAG, GTTTTCATTTCGGATTACCC, TTATCTTACCTATAACTTGT and GTGCGGAAAATGGGTCTGAC, which resulted in a 518 bp deletion beginning at Chromosome X positive strand position 73,419,955 bp, TTTCCACTGCATGAATCTTA, and ending after ATAACAACCTGTCAGACCCAT at 73,420,472 bp (GRCm38/mm10). This mutation deletes exon 4 and 391 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 37 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp92 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)