About   Help   FAQ
Zfp92em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp92em1(IMPC)J
Name: zinc finger protein 92; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5816145
Synonyms: Zfp92em1J
Gene: Zfp92  Location: ChrX:72454702-72471991 bp, + strand  Genetic Position: ChrX, 37.31 cM
Alliance: Zfp92em1(IMPC)J page
IMPC: Zfp92 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfp92-8178J-M8966 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGCTCTAAGATTCATGCAG, GTTTTCATTTCGGATTACCC, TTATCTTACCTATAACTTGT and GTGCGGAAAATGGGTCTGAC, which resulted in a 518 bp deletion beginning at Chromosome X positive strand position 73,419,955 bp, TTTCCACTGCATGAATCTTA, and ending after ATAACAACCTGTCAGACCCAT at 73,420,472 bp (GRCm38/mm10). This mutation deletes exon 4 and 391 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 37 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp92 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory