Agfg2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Agfg2^em1(IMPC)J
• Name: ArfGAP with FG repeats 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5816161
• Synonyms: Agfg2^em1J
• Gene: Agfg2 Location: Chr5:137648725-137682988 bp, - strand Genetic Position: Chr5, 76.59 cM
• Alliance: Agfg2^em1(IMPC)J page
• IMPC: Agfg2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Agfg2-8101J-F2486 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCAAAAGAAACTTTTGGG, CTCAAAGCTTTGCTACCAAG, GCTGTGGCAGGTGAGTGCAC and CACAGAAGATGGTCTCAGTC, which resulted in a 562 bp deletion beginning at Chromosome 5 negative strand position 137,668,182 bp, GCAGGGCTCTACCACTGAGC, and ending after CATGCCACTTGGTAGCAAAG at 137,667,621 bp (GRCm38/mm10). This mutation deletes exon 2 and 468 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 14 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Agfg2 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)