About   Help   FAQ
Clptm1lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Clptm1lem1(IMPC)J
Name: CLPTM1-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817176
Synonyms: Clptm1lem1J
Gene: Clptm1l  Location: Chr13:73752125-73768724 bp, + strand  Genetic Position: Chr13, 40.12 cM
Alliance: Clptm1lem1(IMPC)J page
IMPC: Clptm1l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Clptm1l-8201J-M4248 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCCAAGCTCACCCTCTGAG, GTTTCCTAACGGGACCCCAG, ACTGCAATCTAAGGGCAGCG and ATAGCATTGTATGTAGAGTG, which resulted in a 377 bp deletion beginning at Chromosome 13 positive strand position 73,604,838 bp GAGAGGTAGCCCTCAGATTG, and ending after ATCTAAGGGCAGCGTGGTTT at 73,605,214 bp (GRCm38/mm10). This mutation deletes exon 2 and 441 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Clptm1l Mutation:  34 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/24/2024
MGI 6.24
The Jackson Laboratory