Clptm1l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Clptm1l^em1(IMPC)J
• Name: CLPTM1-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817176
• Synonyms: Clptm1l^em1J
• Gene: Clptm1l Location: Chr13:73752125-73768724 bp, + strand Genetic Position: Chr13, 40.12 cM
• Alliance: Clptm1l^em1(IMPC)J page
• IMPC: Clptm1l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Clptm1l-8201J-M4248 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCCAAGCTCACCCTCTGAG, GTTTCCTAACGGGACCCCAG, ACTGCAATCTAAGGGCAGCG and ATAGCATTGTATGTAGAGTG, which resulted in a 377 bp deletion beginning at Chromosome 13 positive strand position 73,604,838 bp GAGAGGTAGCCCTCAGATTG, and ending after ATCTAAGGGCAGCGTGGTTT at 73,605,214 bp (GRCm38/mm10). This mutation deletes exon 2 and 441 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Clptm1l Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)