About   Help   FAQ
Rab5bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rab5bem1(IMPC)J
Name: RAB5B, member RAS oncogene family; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817196
Synonyms: Rab5bem1J
Gene: Rab5b  Location: Chr10:128513044-128532133 bp, - strand  Genetic Position: Chr10, 77.13 cM
Alliance: Rab5bem1(IMPC)J page
IMPC: Rab5b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Rab5b-8208J-M5447 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTTCCAAGCACTAAGCCGG, AGCTTCATAGATATTAAGTT, ACCAAGGCCCACCAGCTACA and GTTGTAAGTGGGACAAAGGG, which resulted in a 380 bp deletion beginning at Chromosome 10 negative strand position 128,683,459bp GCTGGTGGGCCTTGGTGGCA, and ending after TATGCTTCCAAGCACTAAGC at 128,683,080 bp (GRCm38/mm10). This mutation deletes exon 3 and 228 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rab5b Mutation:  33 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/29/2024
MGI 6.24
The Jackson Laboratory