Gnb2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gnb2^em1(IMPC)J
• Name: guanine nucleotide binding protein (G protein), beta 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817218
• Synonyms: Gnb2^em1J
• Gene: Gnb2 Location: Chr5:137526389-137531772 bp, - strand Genetic Position: Chr5, 76.54 cM
• Alliance: Gnb2^em1(IMPC)J page
• IMPC: Gnb2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gnb2-8128J-M9422 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCATTCTTCAGTGCCCCA, ATGGGCAGAATGATAGTACA, TCCCATTCTTCAGTGCCCCA and ATGATGGGCAGTGCAAGAGA, which resulted in a 359 bp deletion beginning at Chromosome 5 negative strand position 137,530,468 bp, TTTCCCTCTCTTGCACTGCC, and ending after ATGGGCAGAATGATAGTACA at 137,530,110 bp (GRCm38/mm10). This mutation deletes all of exons 3 and 4 and 106 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2bp (AA) deletion 90 bp before the large deletion that will not effect the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 19 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gnb2 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)