Fars2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fars2^em1(IMPC)J
• Name: phenylalanine-tRNA synthetase 2, mitochondrial; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817223
• Synonyms: Fars2^em1J
• Gene: Fars2 Location: Chr13:36301373-36721569 bp, + strand Genetic Position: Chr13, 14.44 cM, cytoband A5
• Alliance: Fars2^em1(IMPC)J page
• IMPC: Fars2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Fars2-8206J-F5419 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCAGAGTCCCTCTACCCT, CTCTGAGCTACCCAGGGTAG, CATTGTGTAACAGATCACTG and CTAAGAAATAGGGAACGGGG, which resulted in a 467 bp deletion beginning at Chromosome 13 positive strand position 36,231,888 bp CCTGGGTAGCTCAGAGCTTG, and ending after AACATTGTGTAACAGATCAC at 36,232,354 bp (GRCm38/mm10). This mutation deletes exon 3 and 307 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 204 and early truncation 35 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fars2 Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)