About   Help   FAQ
Glyctkem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Glyctkem1(IMPC)J
Name: glycerate kinase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817225
Synonyms: Glyctkem1J
Gene: Glyctk  Location: Chr9:106030056-106035337 bp, - strand  Genetic Position: Chr9, 57.46 cM
Alliance: Glyctkem1(IMPC)J page
IMPC: Glyctk gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Glyctk-8207J-M5437 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGAACTTCCAGCTGAGGAG, GGGGTGCCCCGAGTACCATA, GTAAGAGTCTATGGGCGCAG and GGTCTGGCCTGGTTTCTAAA, which resulted in a 457 bp deletion beginning at Chromosome 9 negative strand position 106,157,473 bp, CGCAGGGGGACGCCCTCTAC, and ending after GGTTGGTCACCTCTCCTCAG at 106,157,017 bp (GRCm38/mm10). This mutation deletes exon 3 and 305 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 114 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Glyctk Mutation:  21 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory