Glyctk^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Glyctk^em1(IMPC)J
• Name: glycerate kinase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817225
• Synonyms: Glyctk^em1J
• Gene: Glyctk Location: Chr9:106030056-106035337 bp, - strand Genetic Position: Chr9, 57.46 cM
• Alliance: Glyctk^em1(IMPC)J page
• IMPC: Glyctk gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Glyctk-8207J-M5437 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTGAACTTCCAGCTGAGGAG, GGGGTGCCCCGAGTACCATA, GTAAGAGTCTATGGGCGCAG and GGTCTGGCCTGGTTTCTAAA, which resulted in a 457 bp deletion beginning at Chromosome 9 negative strand position 106,157,473 bp, CGCAGGGGGACGCCCTCTAC, and ending after GGTTGGTCACCTCTCCTCAG at 106,157,017 bp (GRCm38/mm10). This mutation deletes exon 3 and 305 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 114 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Glyctk Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)