About   Help   FAQ
Gpx6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpx6em1(IMPC)J
Name: glutathione peroxidase 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817343
Synonyms: Gpx6em1J
Gene: Gpx6  Location: Chr13:21496295-21503794 bp, + strand  Genetic Position: Chr13, 7.74 cM
Alliance: Gpx6em1(IMPC)J page
IMPC: Gpx6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gpx6-8181J-F8998 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTACCATCTATGGGCACCC, GGTTTACCAACTATCGAGTG, ACACATCTTGGGGAAAGCCT and AGATAGTTGTGGCATTAATG, which resulted in a 576 bp deletion beginning at Chromosome 13 positive strand position 21,313,423 bp CGAGTGAGGTCACAGCTCCC, and ending after TCCATGCTTGAGCTCCAAGG at 21,313,998 bp (GRCm38/mm10). This mutation deletes exon 2 and 422 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gpx6 Mutation:  29 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory