Gpx6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpx6^em1(IMPC)J
• Name: glutathione peroxidase 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817343
• Synonyms: Gpx6^em1J
• Gene: Gpx6 Location: Chr13:21496295-21503794 bp, + strand Genetic Position: Chr13, 7.74 cM
• Alliance: Gpx6^em1(IMPC)J page
• IMPC: Gpx6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gpx6-8181J-F8998 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTACCATCTATGGGCACCC, GGTTTACCAACTATCGAGTG, ACACATCTTGGGGAAAGCCT and AGATAGTTGTGGCATTAATG, which resulted in a 576 bp deletion beginning at Chromosome 13 positive strand position 21,313,423 bp CGAGTGAGGTCACAGCTCCC, and ending after TCCATGCTTGAGCTCCAAGG at 21,313,998 bp (GRCm38/mm10). This mutation deletes exon 2 and 422 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gpx6 Mutation: 30 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)