Mccc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mccc2^em1(IMPC)J
• Name: methylcrotonoyl-Coenzyme A carboxylase 2 (beta); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817349
• Synonyms: Mccc2^em1J
• Gene: Mccc2 Location: Chr13:100085040-100152147 bp, - strand Genetic Position: Chr13, 52.9 cM
• Alliance: Mccc2^em1(IMPC)J page
• IMPC: Mccc2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Mccc2-8043J-M4937 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGGTACAGAAGACACGCTG, ATTTAGAAGCATTTGTTGAT, GTAAAGTGCCGTGTTTGGCG and ACAATGCTCCACGCCAAACA, which resulted in a 511 bp deletion beginning at Chromosome 13 positive strand position 99,993,340 bp, CATGCTGGATGCTGCCATGC, and ending after GCAGATCTCTCAGTTTGGAG at 99,993,850 bp (GRCm38/mm10). This mutation deletes exon 3 and 426 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 34 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mccc2 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)