Bpi^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bpi^em1(IMPC)J
• Name: bactericidal permeablility increasing protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817807
• Synonyms: Bpi^em1J
• Gene: Bpi Location: Chr2:158100014-158126451 bp, + strand Genetic Position: Chr2, 78.72 cM
• Alliance: Bpi^em1(IMPC)J page
• IMPC: Bpi gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Bpi-8189J-M1381 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTATCTCTGTGACATCGGAG, CCTGGCTGTCTGAAGATGCA, TAGGCTGCTTAGGTTCACCG and TTGATGATCACCCTACAAGG, which resulted in a 284 bp deletion beginning at Chromosome 2 positive strand position 158,260,936 bp, GTCTGAAGATGCAGGGGCTG, followed by 16 retained endogenous bases (GTGGAAACTGCCCGT), followed by a second deletion of 96 bp that ends after TGAGACTTTTTCCTCTGCAG at 158,261,331 bp (GRCm38/mm10). This mutation deletes exon 2 and 281 bp of flanking intronic sequence, including the splice acceptor and donor for exon 2 and the splice acceptor for exon 3. This allele has an additional 11 bp deletion (CATCGGAGTGG) 49 bp before the 284 bp deletion that will not effect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 44 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bpi Mutation: 27 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)