Gsg1lem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Gsg1lem1(IMPC)J |
Name: |
GSG1-like; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5817921 |
Synonyms: |
Gsg1lem1J |
Gene: |
Gsg1l Location: Chr7:125477592-125681583 bp, - strand Genetic Position: Chr7, 69.01 cM
|
Alliance: |
Gsg1lem1(IMPC)J page
|
IMPC: |
Gsg1l gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Gsg1l-8187J-M1359 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCAGAGTCTGGTACCTGA, AGCCAGGATGAGGTGGACAG, CTAACAGTTCAGCTGGCAAG and CCCTTTCCAAGTTTAAGCAA, which resulted in a 106 bp deletion beginning at Chromosome 7 negative strand position 125,923,714 bp CTTAAACTTGGAAAGGGCTA, followed by 37 retained endogenous bases (TGGCTGGGGATGGGAGGTATCCTAGAGATGGGACAAG) followed by a second deletion of 303 bp that ends after ATGAGGTGGACAGGGGTGAG at 125,923,269 bp (GRCm38/mm10). In addition there is a 3 bp insertion (AGG)and a 6 bp deletion (CATGGC) 63 bp before the large interrupted deletion that will not alter the effects of the mutation. This mutation deletes exon 4 and 297 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 173 and early truncation 45 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|