Gsg1l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gsg1l^em1(IMPC)J
• Name: GSG1-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817921
• Synonyms: Gsg1l^em1J
• Gene: Gsg1l Location: Chr7:125477592-125681583 bp, - strand Genetic Position: Chr7, 69.01 cM
• Alliance: Gsg1l^em1(IMPC)J page
• IMPC: Gsg1l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gsg1l-8187J-M1359 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCAGAGTCTGGTACCTGA, AGCCAGGATGAGGTGGACAG, CTAACAGTTCAGCTGGCAAG and CCCTTTCCAAGTTTAAGCAA, which resulted in a 106 bp deletion beginning at Chromosome 7 negative strand position 125,923,714 bp CTTAAACTTGGAAAGGGCTA, followed by 37 retained endogenous bases (TGGCTGGGGATGGGAGGTATCCTAGAGATGGGACAAG) followed by a second deletion of 303 bp that ends after ATGAGGTGGACAGGGGTGAG at 125,923,269 bp (GRCm38/mm10). In addition there is a 3 bp insertion (AGG)and a 6 bp deletion (CATGGC) 63 bp before the large interrupted deletion that will not alter the effects of the mutation. This mutation deletes exon 4 and 297 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 173 and early truncation 45 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gsg1l Mutation: 15 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)