About   Help   FAQ
Gsg1lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gsg1lem1(IMPC)J
Name: GSG1-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5817921
Synonyms: Gsg1lem1J
Gene: Gsg1l  Location: Chr7:125477592-125681583 bp, - strand  Genetic Position: Chr7, 69.01 cM
Alliance: Gsg1lem1(IMPC)J page
IMPC: Gsg1l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gsg1l-8187J-M1359 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTCAGAGTCTGGTACCTGA, AGCCAGGATGAGGTGGACAG, CTAACAGTTCAGCTGGCAAG and CCCTTTCCAAGTTTAAGCAA, which resulted in a 106 bp deletion beginning at Chromosome 7 negative strand position 125,923,714 bp CTTAAACTTGGAAAGGGCTA, followed by 37 retained endogenous bases (TGGCTGGGGATGGGAGGTATCCTAGAGATGGGACAAG) followed by a second deletion of 303 bp that ends after ATGAGGTGGACAGGGGTGAG at 125,923,269 bp (GRCm38/mm10). In addition there is a 3 bp insertion (AGG)and a 6 bp deletion (CATGGC) 63 bp before the large interrupted deletion that will not alter the effects of the mutation. This mutation deletes exon 4 and 297 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 173 and early truncation 45 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gsg1l Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory