Hlcs^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Hlcs^em1(IMPC)J
• Name: holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5817955
• Synonyms: Hlcs^-, Hlcs^em1J
• Gene: Hlcs Location: Chr16:93929741-94114430 bp, - strand Genetic Position: Chr16, 55.12 cM, cytoband C4
• Alliance: Hlcs^em1(IMPC)J page
• IMPC: Hlcs gene page

Hlcs^em1(IMPC)J/Hlcs^em1(IMPC)J mice exhibit embryonic lethality. Embryos are recovered at E7.5 but arrest prior to gastrulation and no embryos are seen at E9.5. Embryos are smaller and form a rudimentary egg cylinder but no primitive streak or gastrulation are seen at E7.5.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTGCGTCAGCACCTTCCG, CATGGCTCTAGGACTATGAC, GGACACCTTAGGTTTTTGGC and GAACTTGTAGCTATACAATG, which resulted in a 191 bp deletion beginning at Chromosome 11 negative strand position 121,363,597 bp CAAAAACCTAAGGTGTCCTC, and ending after TGGCTTTCCTCGGAAGGTGC at 121,363,407 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001289443 (exon 2) and 130 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 182 bp deletion spanning Chr11:121,363,645-121,363,826 before the exon deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 49 and early truncation 81 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Hlcs Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)