Chd3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chd3^em1(IMPC)J
• Name: chromodomain helicase DNA binding protein 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5818701
• Synonyms: Chd3^em1J
• Gene: Chd3 Location: Chr11:69234099-69260232 bp, - strand Genetic Position: Chr11, 42.53 cM
• Alliance: Chd3^em1(IMPC)J page
• IMPC: Chd3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Chd3-8127J-F9396 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTACCAGGCTAGAGAAAGTG, TTCTTTCTCTCAGATGGCGA, TGACCTCCATTCAGAACCAG and GTTCCTAGAGAGTGCCACGG, which resulted in a 343 bp deletion beginning at Chromosome 11 negative strand position 69,364,877 bp, ACGGTGGCAGTAAGAAGGGG, and ending after ACTTGGAACCCTAACCCCAC at 69,364,535 bp (GRCm38/mm10). This mutation deletes exon 2 and 230 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 85 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Chd3 Mutation: 102 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)