About   Help   FAQ
Rad54lem1Murr
Endonuclease-mediated Allele Detail
Summary
Symbol: Rad54lem1Murr
Name: RAD54 like (S. cerevisiae); endonuclease-mediated mutation 1, Stephen Murray
MGI ID: MGI:5819211
Gene: Rad54l  Location: Chr4:115951461-115980887 bp, - strand  Genetic Position: Chr4, 53.1 cM
Alliance: Rad54lem1Murr page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and single guide sequence TTGGTGCACTTTGTAAATTC, which resulted in a 4 bp deletion (TTCT) at Chromosome 4 negative strand position 116,105,771 bp and ending after 116,105,767 bp(GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 342 and early truncation 18 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rad54l Mutation:  46 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory