Zfp7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp7^em1(IMPC)J
• Name: zinc finger protein 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5819276
• Synonyms: Zfp7^em1J
• Gene: Zfp7 Location: Chr15:76763459-76776595 bp, + strand Genetic Position: Chr15, 36.28 cM
• Alliance: Zfp7^em1(IMPC)J page
• IMPC: Zfp7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfp7-8177J-F8938 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGCTGTGTCTGTTCAGTG, AGGTATGCGATCAGGCCCAG, CCGGTCTGACCGGTTCCCAG and CCAGGTCTGCTCCAAACCCC, which resulted in a 436 bp deletion beginning at Chromosome 15 positive strand position 76,880,855 bp GGCCTGATCGCATACCTAGC, and ending after CTCCAAACCCCGGGCACGTG at 76,881,288 bp (GRCm38/mm10). This mutation deletes exon 3 and 307 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp7 Mutation: 46 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)