4930447C04Rik^em1Amp
Endonuclease-mediated Allele Detail

Summary

• Symbol: 4930447C04Rik^em1Amp
• Name: RIKEN cDNA 4930447C04 gene; endonuclease-mediated mutation 1, Alberto M Pendas
• MGI ID: MGI:5823358
• Synonyms: Six6os1^-
• Gene: 4930447C04Rik Location: Chr12:72926967-72964742 bp, - strand Genetic Position: Chr12, 30.3 cM, cytoband C3
• Alliance: 4930447C04Rik^em1Amp page

Mutation origin

• Strain of Origin: (C57BL/6J x CBA/J)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A 124bp deletion (GRCm39:chr12:72963494-72963618) that includes part of exon 2, intron 2 and part of exon 3 was created by CRISPR/Cas9 genome editing using sgRNAs (targeting CACCGATCTGTTTGTCAGTTTGGAC, AAACGTCCAAACTGACAAACAGATC, CACCGTACTTATGTCTTGCTCATAC and AAACGTATGACAAGACATAAGTAC). Spermatocytes from homozygous mice showed no protein expression by immunofluorescence studies, suggesting that this is a null allele. (J:238491)

Expression

In Structures Affected by this Mutation:

6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any 4930447C04Rik Mutation: 29 strains or lines available

References

• Original: J:238491 Gomez-H L, et al., C14ORF39/SIX6OS1 is a constituent of the synaptonemal complex and is essential for mouse fertility. Nat Commun. 2016 Oct 31;7:13298
• All: 2 reference(s)