Mark1^em#Akiki
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mark1^em#Akiki
• Name: MAP/microtubule affinity regulating kinase 1; endonuclease-mediated mutation, Akira Kikuchi
• MGI ID: MGI:5823379
• Gene: Mark1 Location: Chr1:184628986-184731767 bp, - strand Genetic Position: Chr1, 89.26 cM
• Alliance: Mark1^em#Akiki page

Mutation origin

• Strain of Origin: (C57BL/6 x C3H)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Not Specified
• Mutation details: Triple mutants were created with exons 2, 14 and 18 targeted. Exon 2 guide RNA target sequence: AGCATACGTCTGTGGATGGC; exon 14 target sequence: CGTATATTCTGGCGGTAGCA; exon 18 target sequence: AACGACATGCTGAGGGAGAT. Seven triple mutants were identified through qPCR. The specific mutations in these strains are not reported. The pound (#) symbol is used for the pool of all seven founders. (J:238422)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Mark1 Mutation: 33 strains or lines available

References

• Original: J:238422 Fumoto K, et al., Modulation of apical constriction by Wnt signaling is required for lung epithelial shape transition. Development. 2017 Jan 01;144(1):151-162
• All: 2 reference(s)