About   Help   FAQ
Mark1em#Akiki
Endonuclease-mediated Allele Detail
Summary
Symbol: Mark1em#Akiki
Name: MAP/microtubule affinity regulating kinase 1; endonuclease-mediated mutation, Akira Kikuchi
MGI ID: MGI:5823379
Gene: Mark1  Location: Chr1:184628986-184731767 bp, - strand  Genetic Position: Chr1, 89.26 cM
Alliance: Mark1em#Akiki page
Mutation
origin
Strain of Origin:  (C57BL/6 x C3H)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsTriple mutants were created with exons 2, 14 and 18 targeted. Exon 2 guide RNA target sequence: AGCATACGTCTGTGGATGGC; exon 14 target sequence: CGTATATTCTGGCGGTAGCA; exon 18 target sequence: AACGACATGCTGAGGGAGAT. Seven triple mutants were identified through qPCR. The specific mutations in these strains are not reported. The pound (#) symbol is used for the pool of all seven founders. (J:238422)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mark1 Mutation:  33 strains or lines available
References
Original:  J:238422 Fumoto K, et al., Modulation of apical constriction by Wnt signaling is required for lung epithelial shape transition. Development. 2017 Jan 01;144(1):151-162
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory