Gpd1l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpd1l^em1(IMPC)J
• Name: glycerol-3-phosphate dehydrogenase 1-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5823414
• Synonyms: Gpd1l^em1J
• Gene: Gpd1l Location: Chr9:114728409-114763055 bp, - strand Genetic Position: Chr9, 65.47 cM
• Alliance: Gpd1l^em1(IMPC)J page
• IMPC: Gpd1l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gpd1l-8296J-M9231 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAAGTCAGAGCCAGCCAA, TTGAGTGGCACCAGGACCTG, GGACTTGTGCGGGCTCCGAA and TATAAGAACAGAGTTTTCAG, which resulted in a 356 bp deletion beginning at Chromosome 9 negative strand position 114,920,771 bp, CGAATGGAAGTGCGAGACTT, and ending after AAGCAACCTTTGGCTGGCTC at 114,920,416 bp (GRCm38/mm10). This mutation deletes exon 2 and 178 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 9 bp deletion (AGTTTTCAG) 48 bp before the 356 bp deletion that will not alter the results of the larger deletion. This mutation is predicted to cause a change of amino acid sequence after residue 16 and early truncation 48 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gpd1l Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)