About   Help   FAQ
Gpd1lem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpd1lem1(IMPC)J
Name: glycerol-3-phosphate dehydrogenase 1-like; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5823414
Synonyms: Gpd1lem1J
Gene: Gpd1l  Location: Chr9:114728409-114763055 bp, - strand  Genetic Position: Chr9, 65.47 cM
Alliance: Gpd1lem1(IMPC)J page
IMPC: Gpd1l gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Gpd1l-8296J-M9231 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAAGTCAGAGCCAGCCAA, TTGAGTGGCACCAGGACCTG, GGACTTGTGCGGGCTCCGAA and TATAAGAACAGAGTTTTCAG, which resulted in a 356 bp deletion beginning at Chromosome 9 negative strand position 114,920,771 bp, CGAATGGAAGTGCGAGACTT, and ending after AAGCAACCTTTGGCTGGCTC at 114,920,416 bp (GRCm38/mm10). This mutation deletes exon 2 and 178 bp of flanking intronic sequence including the splice acceptor and donor. There is an additional 9 bp deletion (AGTTTTCAG) 48 bp before the 356 bp deletion that will not alter the results of the larger deletion. This mutation is predicted to cause a change of amino acid sequence after residue 16 and early truncation 48 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gpd1l Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory