About   Help   FAQ
Dusp18em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dusp18em1(IMPC)J
Name: dual specificity phosphatase 18; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5823442
Synonyms: Dusp18em1J
Gene: Dusp18  Location: Chr11:3845240-3851296 bp, + strand  Genetic Position: Chr11, 2.74 cM
Alliance: Dusp18em1(IMPC)J page
IMPC: Dusp18 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Dusp18-8276J-M2282 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAGACCGTGAACAATGGAA, GGTCTTTTCACACAGAGGAA, GAACTCCTCAGGCCGCAGAG and GCAAATCCCTAAAACAGGTA, which resulted in a 4631 bp deletion beginning at Chromosome 11 positive strand position 3,896,766 bp CATTGTTCACGGTCTCTCTG, and ending after AAGGGAACTCCTCAGGCCGC at 3,901,396 bp (GRCm38/mm10). This mutation deletes exon 2, which is the only translated exon, along with 277 bp of flanking intronic sequence, including the splice acceptor and donor, so it is predicted to result in a complete null. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dusp18 Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory