Dusp18^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dusp18^em1(IMPC)J
• Name: dual specificity phosphatase 18; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5823442
• Synonyms: Dusp18^em1J
• Gene: Dusp18 Location: Chr11:3845240-3851296 bp, + strand Genetic Position: Chr11, 2.74 cM
• Alliance: Dusp18^em1(IMPC)J page
• IMPC: Dusp18 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dusp18-8276J-M2282 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAGACCGTGAACAATGGAA, GGTCTTTTCACACAGAGGAA, GAACTCCTCAGGCCGCAGAG and GCAAATCCCTAAAACAGGTA, which resulted in a 4631 bp deletion beginning at Chromosome 11 positive strand position 3,896,766 bp CATTGTTCACGGTCTCTCTG, and ending after AAGGGAACTCCTCAGGCCGC at 3,901,396 bp (GRCm38/mm10). This mutation deletes exon 2, which is the only translated exon, along with 277 bp of flanking intronic sequence, including the splice acceptor and donor, so it is predicted to result in a complete null. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dusp18 Mutation: 8 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)