Tbc1d8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbc1d8^em1(IMPC)J
• Name: TBC1 domain family, member 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5823470
• Synonyms: Tbc1d8^em1J
• Gene: Tbc1d8 Location: Chr1:39410573-39517836 bp, - strand Genetic Position: Chr1, 18.3 cM, cytoband B
• Alliance: Tbc1d8^em1(IMPC)J page
• IMPC: Tbc1d8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tbc1d8-8160J-M2435 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AAGCGGTGCTAAGTACCCCT, ACACTTTTGCTTAATTACAT, CCTTCAGTCTAACTGTTGTC and GTAAGAACCCAACCTTGTTT, which resulted in a 449 bp deletion beginning at Chromosome 1 negative strand position 39,405,659 bp, AACAAGGTTGGGTTCTTACA, and ending after GGTACTTAGCACCGCTTCCG at 39,405,211 bp (GRCm38/mm10). This mutation deletes exon 4 and 220 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp deletion (AC) 80 bp before the 449 bp deletion that will not effect the results of this deletion. This mutation is predicted to cause a change of amino acid sequence after residue 119 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tbc1d8 Mutation: 54 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)