Cntnap5a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cntnap5a^em1(IMPC)J
• Name: contactin associated protein-like 5A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5823560
• Synonyms: Cntnap5a^em1J
• Gene: Cntnap5a Location: Chr1:115612486-116515053 bp, + strand Genetic Position: Chr1, 51.59 cM
• Alliance: Cntnap5a^em1(IMPC)J page
• IMPC: Cntnap5a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Cntnap5a-8274J-F2258 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGGACTATGAACCTACTA, ATTTCATGGATCTTTACCAC, TCTTACTGTAACCTGATTGT and ACTAATACTCTTATTCCCTT, which resulted in a 660 bp deletion beginning at Chromosome 1 positive strand position 115,914,854 bp, GTCCCCTAGTAGGTTCATAG and ending after GTAGCTCTATCCAAAGGGAA at 115,915,513 bp (GRCm38/mm10). This mutation deletes exon 3 and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 62 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cntnap5a Mutation: 83 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)