About   Help   FAQ
Cntnap5aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cntnap5aem1(IMPC)J
Name: contactin associated protein-like 5A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5823560
Synonyms: Cntnap5aem1J
Gene: Cntnap5a  Location: Chr1:115612486-116515053 bp, + strand  Genetic Position: Chr1, 51.59 cM
Alliance: Cntnap5aem1(IMPC)J page
IMPC: Cntnap5a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Cntnap5a-8274J-F2258 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGGACTATGAACCTACTA, ATTTCATGGATCTTTACCAC, TCTTACTGTAACCTGATTGT and ACTAATACTCTTATTCCCTT, which resulted in a 660 bp deletion beginning at Chromosome 1 positive strand position 115,914,854 bp, GTCCCCTAGTAGGTTCATAG and ending after GTAGCTCTATCCAAAGGGAA at 115,915,513 bp (GRCm38/mm10). This mutation deletes exon 3 and 466 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 62 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cntnap5a Mutation:  83 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory