Pdzrn3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pdzrn3^em1(IMPC)J
• Name: PDZ domain containing RING finger 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825050
• Synonyms: Pdzrn3^em1J
• Gene: Pdzrn3 Location: Chr6:101126570-101354858 bp, - strand Genetic Position: Chr6, 46.95 cM
• Alliance: Pdzrn3^em1(IMPC)J page
• IMPC: Pdzrn3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Pdzrn3-8311J-M0809 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATTAGTTAAGTAACCCGCA, AGGAGGCCGGAGATGCACCC, ACTTCCTCGGAAAATGCCCG and CCCTCCCTATGGCCAAAAGA, which resulted in a 1147 bp deletion beginning at Chromosome 6 negative strand position 101,378,125 bp AAAGAGGGTCGTGAGGCCCC, and ending after CCAGCTGTATCACTCCGTGC at 101,376,979 bp (GRCm38/mm10). This mutation deletes exon 1 and 415 bp of flanking intronic sequence including the translation start site and splice donor and is predicted to cause a null unless there is an alternative ATG that is used. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pdzrn3 Mutation: 51 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)