Mgme1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Mgme1em1(IMPC)J |
Name: |
mitochondrial genome maintenance exonuclease 1; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:5825054 |
Synonyms: |
Mgme1em1J |
Gene: |
Mgme1 Location: Chr2:144112824-144123147 bp, + strand Genetic Position: Chr2, 70.98 cM, cytoband H1
|
Alliance: |
Mgme1em1(IMPC)J page
|
IMPC: |
Mgme1 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele from project Mgme1-8310J-M0767 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTGAAATTTTGTATCTAA, AGGGTGAAATTTTGTATCTA, GTGCCTCCTTCAGTCACTGT and GGTGGGCCAGGATTGTCTAT, which resulted in a 426 bp deletion beginning at Chromosome 2 positive strand position 144,276,173bp CTAAGGGTTTTCCATTTAAA, and ending after AATGGGTGGGCCAGGATTGT at 144,276,598 bp (GRCm38/mm10). This mutation deletes exon 3 and 209 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 5 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
3 reference(s) |
|