Apmap^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Apmap^em1(IMPC)J
• Name: adipocyte plasma membrane associated protein; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825060
• Synonyms: Apmap^em1J
• Gene: Apmap Location: Chr2:150425000-150450487 bp, - strand Genetic Position: Chr2, 74.68 cM
• Alliance: Apmap^em1(IMPC)J page
• IMPC: Apmap gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Apmap-8259J-M2499 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTACACAGCTCCCAGACAG, GTTGCCACTGTTGCTCAGGG, CCATACCGCAGACATCCTGA and AACTGTCTTGAGGCCATGGG, which resulted in a 434 bp deletion beginning at Chromosome 2 negative strand position 150,594,667 bp, GTGATGAGACCGTCAGGATG, and ending after TGCCACTGTTGCTCAGGGTG at 150,594,234 bp (GRCm38/mm10). This mutation deletes exon 3 and 318 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 1 bp insertion 43 bases before the deletion that will not affect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 69 and early truncation 15 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Apmap Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)