Igf2bp3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igf2bp3^em1(IMPC)J
• Name: insulin-like growth factor 2 mRNA binding protein 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825102
• Synonyms: Igf2bp3^em1J
• Gene: Igf2bp3 Location: Chr6:49062157-49191891 bp, - strand Genetic Position: Chr6, 23.82 cM, cytoband B2.3
• Alliance: Igf2bp3^em1(IMPC)J page
• IMPC: Igf2bp3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Igf2bp3-8307J-M0642 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAACAATAACCCAGAAGCA, TGTGCTTCCTCCCTAAAAAG, ACACACAAGAGGCAAGACGA and AAAAGCCACACCCACCCGAA, which resulted in a 447 bp deletion beginning at Chromosome 6 negative strand position 49,213,510 bp CCGAAGGGTCAGCTCTGCAC, and ending after TTGCCTGCGGCCCCTGCTTC at 49,213,064 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Igf2bp3 Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)