Efhd1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Efhd1^em1(IMPC)J
• Name: EF hand domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825125
• Synonyms: Efhd1^em1J
• Gene: Efhd1 Location: Chr1:87192085-87238561 bp, + strand Genetic Position: Chr1, 44.15 cM
• Alliance: Efhd1^em1(IMPC)J page
• IMPC: Efhd1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Efhd1-8204J-F5406 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCGGAGGCTTGCAAAGCAGG, GGAGGTGCCTTACTGTGAAG, AACCAGGGAGCATTCTCAAT and TGCCGATTGAGAATGCTCCC, which resulted in a 540 bp deletion beginning at Chromosome 1 negative strand position 87,289,692 bp ATTCTCAATCGGCAGATCCA, and ending after GGACCCAACACCTCCAAATG at 87,289,147 bp (GRCm38/mm10). This mutation deletes exon 2 and 392 bp of flanking intronic sequence (retains 6 bp CTCCGC at 87289348-87289343) including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 102 and early truncation 58 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Efhd1 Mutation: 20 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)