Chmp7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chmp7^em1(IMPC)J
• Name: charged multivesicular body protein 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825131
• Synonyms: Chmp7^em1J
• Gene: Chmp7 Location: Chr14:69954449-69969990 bp, - strand Genetic Position: Chr14, 36.09 cM
• Alliance: Chmp7^em1(IMPC)J page
• IMPC: Chmp7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Chmp7-8200J-F4216 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAAATGTAAAAATAACCCA, GCTGATTACTTCCGGACAGT, GTTAATATAATGCCTCTGAG and TGCGACAGACAGCCTGTCCT, which resulted in a 385 bp deletion beginning at Chromosome 14 negative strand position 69,730,348 bp CAGGCTGTCTGTCGCATTAC, and ending after TAGGGTTATATATTCCTTGG at 69,729,964 bp (GRCm38/mm10). This mutation deletes exon 2 and 213 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 25 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Chmp7 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)