Tbc1d16^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tbc1d16^em1(IMPC)J
• Name: TBC1 domain family, member 16; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825264
• Synonyms: Tbc1d16^em1J
• Gene: Tbc1d16 Location: Chr11:119033871-119119325 bp, - strand Genetic Position: Chr11, 83.34 cM
• Alliance: Tbc1d16^em1(IMPC)J page
• IMPC: Tbc1d16 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tbc1d16-8341J-M1322 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCAGGCTTAGGGCCACCACA, GCCTCACTACCCAGCCTGGT, TGGCTTGTCGTTCTAAATGG and AGAAAGCCATTGCTGACTGG, which resulted in a 958 bp deletion beginning at Chromosome 11 negative strand position 119,209,527 bp, GACTGGAGGAGACCCAAGTG, and ending after CAGCCTCACTACCCAGCCTG at 119,208,570 bp (GRCm38/mm10). This mutation deletes exon 3 and 360 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an indel 26 bp after the deletion (AGCCAAGA insertion/TTTAG deletion) that will not alter the effect of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 59 and early truncation 145 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tbc1d16 Mutation: 46 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)