Rtl10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rtl10^em1(IMPC)J
• Name: retrotransposon Gag like 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5825309
• Synonyms: Rtl10^em1J
• Gene: Rtl10 Location: Chr16:18319883-18320924 bp, + strand Genetic Position: Chr16, 11.46 cM
• Alliance: Rtl10^em1(IMPC)J page
• IMPC: Rtl10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Gm16314-8293J-M2383 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGGGCAGAAAACCCTAA, GCTCAACCATCACCTCTGAC, GGTTAGACCTCAACCAAGCA and GTGCTCAGAAGCCCTAGCAT, which resulted in a 942 bp deletion beginning at Chromosome 16 positive strand position 18,500,884 bp, GTCAGAGGTGATGGTTGAGC, and ending after TCCCTCCAAACCCTGCTTG at 18,501,825 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the translation start and stop and is predicted to result in a null mutation. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rtl10 Mutation: 3 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)